pGL3-basic-hRARβP-FL-luciferase
(Plasmid #135447)

• Purpose: Human full-length promoter of retinoic acid receptor-beta gene in pGL3-Basic-luciferase plasmid vector
• Depositing Lab: Catharine Ross
• Publication: Zolfaghari et al Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27.

Backbone

• Vector backbone: pGL3-Basic-luciferase
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6735

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Follow the protocol from Promega.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Full-length promoter of human retinoic acid receptor-beta gene
• Alt name: RARβ promoter
• Species: H. sapiens (human)
• Insert Size (bp): 1917
• GenBank ID: NC_000003
• Promoter: Human RARβ promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (destroyed during cloning)
• 3′ cloning site: SacII (destroyed during cloning)
• 5′ sequencing primer: CCAATGCACATTCCAACACT
• 3′ sequencing primer: GATCCCAAGTTCTCCTTCCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The PCR amplified DNA fragment including the full length RARβ promoter and partial 5′-UTR of the RARβ mRNA was cloned in pGEM-T Easy plasmid vector by TA cloning (Promega), double digested with NdeI/SacII, blunt-ended and then sub-cloned into the Sma-I site of the pGL3-Basic-Luciferase from Promega.