pGL3-basic-hRARβP-FL-luciferase
(Plasmid
#135447)
-
PurposeHuman full-length promoter of retinoic acid receptor-beta gene in pGL3-Basic-luciferase plasmid vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic-luciferase
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 6735
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFull-length promoter of human retinoic acid receptor-beta gene
-
Alt nameRARβ promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1917
-
GenBank IDNC_000003
- Promoter Human RARβ promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (destroyed during cloning)
- 3′ cloning site SacII (destroyed during cloning)
- 5′ sequencing primer CCAATGCACATTCCAACACT
- 3′ sequencing primer GATCCCAAGTTCTCCTTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The PCR amplified DNA fragment including the full length RARβ promoter and partial 5′-UTR of the RARβ mRNA was cloned in pGEM-T Easy plasmid vector by TA cloning (Promega), double digested with NdeI/SacII, blunt-ended and then sub-cloned into the Sma-I site of the pGL3-Basic-Luciferase from Promega.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-basic-hRARβP-FL-luciferase was a gift from Catharine Ross (Addgene plasmid # 135447 ; http://n2t.net/addgene:135447 ; RRID:Addgene_135447) -
For your References section:
CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331