Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

L1_lacZgRNA-Ck3
(Plasmid #136136)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136136 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCk3
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p5-MpU6:lacZgRNA
  • gRNA/shRNA sequence
    scaffold: tttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
  • Species
    Marchantia polymorpha
  • Mutation
    BsaI/ SapI domesticated

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    L1_lacZgRNA-Ck3 was a gift from Jim Haseloff (Addgene plasmid # 136136 ; http://n2t.net/addgene:136136 ; RRID:Addgene_136136)
  • For your References section:

    Systematic tools for reprogramming plant gene expression in a simple model, Marchantia polymorpha. Sauret-Gueto S, Frangedakis E, Silvestri L, Rebmann M, Tomaselli M, Markel K, Delmans M, West A, Patron NJ, Haseloff J. ACS Synth Biol. 2020 Mar 12. doi: 10.1021/acssynbio.9b00511. 10.1021/acssynbio.9b00511 PubMed 32163700