gRNA-HEK3-Puro
(Plasmid #136282)

• Purpose: Expresses a guide RNA targeting HEK3 site
• Depositing Lab: Zhaohui Ye
• Publication: McGrath et al Nat Commun. 2019 Nov 25;10(1):5353. doi: 10.1038/s41467-019-13342-8.

Backbone

• Vector backbone: pSpCas9(BB)-2A-Puro (PX459) V2.0
• Backbone manufacturer: Feng Zhang
• Backbone size w/o insert (bp): 4800
• Total vector size (bp): 4838
• Modifications to backbone: Cas9-T2A-Puro removed from PX459 from AgeI to EcoR I, Puro inserted back at AgeI and EcoRI. HEK3 protospacer sequence was cloned into the vector according procedure described in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988)
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: sgRNA-HEK3
• Species: Synthetic
• Insert Size (bp): 20
• Promoter: U6

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: LKO1.5'
• 3′ sequencing primer: gtgggcttgtactcggtcat

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is a plasmid expressing sgRNA targeting HEK3 site. It co-expressed a puromycin resistance gene under the control of Cbh promoter. The vector is modified from pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988) and no longer expresses the Cas9 gene.