U6_sgRNA_CAG_hSt1Cas9_CNRZ1066
(Plasmid #136651)

• Purpose: A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:CNRZ1066 chimera) and its U6-driven sgRNA.
• Depositing Lab: Yannick Doyon
• Publication: Agudelo et al Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3.

Backbone

• Vector backbone: MSP1594_2x_NLS (Plasmid #110625)
• Total vector size (bp): 8715
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: St1Cas9 LMD-9:CNRZ_1066 Chimera
• Species: H. sapiens (human), Synthetic
• Promoter: CAG
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCTACAGCTCCTGGGCAACG

Gene/Insert 2

• Gene/Insert name: sgRNA for St1Cas9
• Species: H. sapiens (human), Synthetic
• Promoter: hU6

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: U6

Resource Information

• Supplemental Documents:
  • U6_sgRNA_CAG_hSth1Cas9_CNRZ.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry