Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA
(Plasmid #136652)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 136652 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    MSP1594_2x_NLS (Plasmid #110625)
  • Total vector size (bp) 8715
  • Vector type
    Mammalian Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    St1Cas9 LMD-9
  • Species
    H. sapiens (human), Synthetic
  • Promoter CAG
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)
    • APOBEC-1 (N terminal on insert)
    • 2xUGI (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtgggccacaggcctgaag
  • 3′ sequencing primer AGCCCTGCTGAAGTCCAACTTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA for St1Cas9
  • Species
    H. sapiens (human), Synthetic
  • Promoter U6

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    APOBEC-1
  • Species
    H. sapiens (human)
  • Entrez Gene
    APOBEC1 (a.k.a. APO1, APOBEC-1, BEDP, CDAR1, HEPR)
  • Promoter CAG
  • Tag / Fusion Protein
    • hSt1Cas9 (C terminal on insert)

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    UGI
  • Species
    H. sapiens (human), Synthetic
  • Promoter CAG
  • Tag / Fusion Protein
    • hSt1Cas9 (N terminal on insert)

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    HA tag
  • Species
    Synthetic
  • Tag / Fusion Protein
    • UGI (N terminal on insert)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6_sgRNA_CAG_APOBEC-1_hSt1Cas9_LMD9_2xUGI_3xHA was a gift from Yannick Doyon (Addgene plasmid # 136652 ; http://n2t.net/addgene:136652 ; RRID:Addgene_136652)
  • For your References section:

    Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Agudelo D, Carter S, Velimirovic M, Duringer A, Rivest JF, Levesque S, Loehr J, Mouchiroud M, Cyr D, Waters PJ, Laplante M, Moineau S, Goulet A, Doyon Y. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. 10.1101/gr.255414.119 PubMed 31900288