1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 13668: pQLinkHD
  • Gateway cassette

  • pDESTco

  • 2342

  • EF025686

  • His

  • N terminal on backbone

  • pQE-2
    (Search Vector Database)

  • Qiagen

  • Bacterial Expression

  • Co-Expression

  • 4720

  • Gateway Cloning

  • attR1

  • Yes

  • attR2

  • Yes

  • pQE65, TGAGCGGATAACAATTTCACACAG List of Sequencing Primers

  • pQE276, GGCAACCGAGCGTTCTGAAC

  • Ampicillin and Chloramphenicol

  • DB3.1

  • 37

  • DB3.1 from Invitrogen

  • Unknown

  • View sequences (2)
  • Konrad Buessow

  • MTA

Comments: 

Please note that the chloramphenicol resistance gene outside of the attB sites in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Vectors for co-expression of an unrestricted number of proteins. Scheich et al (Nucleic Acids Res. 2007 Feb 20. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 13668" in your Materials and Methods section.