pTet-GLI2shR
(Plasmid
#136691)
-
PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTet-pLKO-puro (Plasmid #21915)
- Backbone size w/o insert (bp) 8758
- Total vector size (bp) 8815
-
Modifications to backboneTet-pLKO-puro (Plasmid #21915) was digested with AgeI and EcoRI to insert Gli2 shRNA-coding sequence (aattaaaaacctggcatgactaccactatgctcgagcatagtggtagtcatgccagg). The resulting pTet-GLI2shR plasmid was confirmed by single digestion with XhoI (Expected bands: 8447bp, 190bp, 136bp, 42bp)
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshRNA_humanGli2
-
gRNA/shRNA sequenceaattaaaaacctggcatgactaccactatgctcgagcatagtggtagtcatgccagg
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001371271
-
Entrez GeneGLI2 (a.k.a. CJS, HPE9, PHS2, THP1, THP2)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTet-GLI2shR was a gift from LuZhe Sun (Addgene plasmid # 136691 ; http://n2t.net/addgene:136691 ; RRID:Addgene_136691) -
For your References section:
Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo. Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, Wang B, Sun LZ, Zhu X. Lab Invest. 2018 Nov;98(11):1384-1396. doi: 10.1038/s41374-018-0089-5. Epub 2018 Jul 2. 10.1038/s41374-018-0089-5 PubMed 29967343