AAVS1-Puro CAG FUCCI
(Plasmid #136934)

• Purpose: donor plasmid for constitutive FUCCI expression in human cells
• Depositing Lab: Xiaoping Bao
• Publication: Chang et al Biotechnol Bioeng. 2020 Apr 11. doi: 10.1002/bit.27352.

Backbone

• Vector backbone: AAVS1 Puro CAG
• Backbone manufacturer: Addgene Plasmid #80945
• Backbone size w/o insert (bp): 10235
• Total vector size (bp): 12890
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
• Alt name: FUCCI
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2655
• Promoter: CAG
• Tags / Fusion Proteins:
  • Clover (N terminal on insert)
  • mKO2 (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: gctaaccatgttcatgccttc
• 3′ sequencing primer: none

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120) was cloned from Addgene #83841, a gift from Dr. Michael Lin Lab
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry