pLRC1-NEK10p:NEK10-3XFLAG
(Plasmid #137030)

• Purpose: Lentiviral vector for expressing NEK10 under the control of the endogenous NEK10 promoter
• Depositing Lab: David Sabatini
• Publication: Chivukula et al Nat Med. 2020 Jan 20. pii: 10.1038/s41591-019-0730-x. doi: 10.1038/s41591-019-0730-x.

Backbone

• Vector backbone: pLRC1
• Backbone size w/o insert (bp): 8454
• Total vector size (bp): 11843
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NIMA-like kinase 10
• Alt name: NEK10
• Species: H. sapiens (human)
• Insert Size (bp): 3389
• Entrez Gene: NEK10 (a.k.a. FLJ32685)
• Promoter: human NEK10 endogenous promoter
• Tag / Fusion Protein:
  • 3XFLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggcccgaaggaatagaagaa
• 3′ sequencing primer: actgccatttgtctcgaggt

Resource Information

• Supplemental Documents:
  • pLRC1-NEK10p_NEK10-3XFLAG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry