pAAV-Ef1a-Coff/Fon-BFP
(Plasmid
#137131)
-
PurposeIntersectional viral expression of BFP in cells expressing Flp AND NOT Cre
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 137131 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2-EF1a-WPRE
- Backbone size w/o insert (bp) 5300
-
Vector typeAAV, Cre/Lox, Synthetic Biology ; Flp/FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCoff/Fon-BFP
-
SpeciesSynthetic; Prokaryotic
-
Insert Size (bp)1300
-
Mutationn/a
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
- 3′ sequencing primer GGGCCACAACTCCTCATAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Additional sequencing primers: Intron 1F GGGACGACATGACTTAACCAG; Intron 1R CCAGCCCTTCTCATGTTCAG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-Coff/Fon-BFP was a gift from Karl Deisseroth & INTRSECT 2.0 Project (Addgene plasmid # 137131 ; http://n2t.net/addgene:137131 ; RRID:Addgene_137131) -
For your References section:
Comprehensive Dual- and Triple-Feature Intersectional Single-Vector Delivery of Diverse Functional Payloads to Cells of Behaving Mammals. Fenno LE, Ramakrishnan C, Kim YS, Evans KE, Lo M, Vesuna S, Inoue M, Cheung KYM, Yuen E, Pichamoorthy N, Hong ASO, Deisseroth K. Neuron. 2020 Jun 20. pii: S0896-6273(20)30432-3. doi: 10.1016/j.neuron.2020.06.003. 10.1016/j.neuron.2020.06.003 PubMed 32574559