pBV-luc TOP2A 500bp promoter
(Plasmid
#138273)
-
PurposeLuciferase reporter plasmid driven by TOP2A promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138273 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBV-luc
-
Backbone manufacturerBert Vogelstein (Addgene plasmid #16539)
- Backbone size w/o insert (bp) 4867
- Total vector size (bp) 5339
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTOP2A promoter sequence
-
SpeciesH. sapiens (human)
-
Insert Size (bp)500
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctagcaaaataggctgtccc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBV-luc TOP2A 500bp promoter was a gift from Wen Xue (Addgene plasmid # 138273 ; http://n2t.net/addgene:138273 ; RRID:Addgene_138273) -
For your References section:
Depletion of TRRAP induces p53-independent senescence in liver cancer by downregulating mitotic genes. Kwan SY, Sheel A, Song CQ, Zhang XO, Jiang T, Dang H, Cao Y, Ozata DM, Mou H, Yin H, Weng Z, Wang XW, Xue W. Hepatology. 2019 Jun 12. doi: 10.1002/hep.30807. 10.1002/hep.30807 PubMed 31188495