pAJ1
(Plasmid #138379)

• Purpose: pEcRNAP6 derivative encoding Escherichia coli core RNA polymerase subunits: RpoA, RpoB, RpoC(His)10, RpoZ
• Depositing Lab: Seth Darst
• Publication: Cartagena et al Proc Natl Acad Sci U S A. 2019 Sep 17;116(38):18923-18927. doi: 10.1073/pnas.1910827116. Epub 2019 Sep 4.

Backbone

• Vector backbone: pET21a
• Backbone size w/o insert (bp): 15815
• Total vector size (bp): 5000
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: RpoA
• Species: E. coli
• Insert Size (bp): 990
• GenBank ID: 947794
• Entrez Gene: rpoA (a.k.a. b3295, ECK3282, pez, phs, sez)
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: T7
• 3′ sequencing primer: cgctgacaagtccacggatcggggatccgg

Gene/Insert 2

• Gene/Insert name: RpoB
• Species: E. coli
• Insert Size (bp): 4029
• GenBank ID: 948488
• Entrez Gene: rpoB (a.k.a. b3987, ECK3978, ftsR, groN, nitB, rif, ron, sdgB, stl, stv, tabD)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ccgtcgacttgtcagcgagctgaggaaccc
• 3′ sequencing primer: ggttttaacccgacagcagtgacctgtttgagcg

Gene/Insert 3

• Gene/Insert name: RpoC
• Alt name: RpoC dCT
• Species: E. coli
• Insert Size (bp): 4185
• Mutation: Clamp toe deletion: Δ(Tyr144-Lys179) ::(G144-S145). PreScission protease site (GE Healthcare; LEVLFQGP) is inserted between the C-terminus of RpoC and the (His)10-tag
• GenBank ID: 948487
• Entrez Gene: rpoC (a.k.a. b3988, ECK3979, tabB)
• Tag / Fusion Protein:
  • His10 (C terminal on insert)

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: gcggattgtgctaactccgacgggagcaaatcc
• 3′ sequencing primer: gcttattttgagtggactattgaggccagag

Gene/Insert 4

• Gene/Insert name: rpoZ
• Species: E. coli
• Insert Size (bp): 276
• GenBank ID: 948160
• Entrez Gene: rpoZ (a.k.a. b3649, ECK3639, spoS)

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: gcttcaatgactgcagacttaagaaggagattaatg
• 3′ sequencing primer: ccccgaaaagtgccacctgacgtagttatccg

Resource Information

• Supplemental Documents:
  • pAJ1 RNAP dCTH core expression construct.gb
• A portion of this plasmid was derived from a plasmid made by: pEcRNAP6, Twist KA, Husnain SI, Franke JD, Jain D, Campbell EA, Nickels BE, Thomas MS, Darst SA, Westblade LF

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A novel method for the production of in vivo-assembled, recombinant Escherichia coli RNA polymerase lacking the alpha C-terminal domain.2
Twist KA, Husnain SI, Franke JD, Jain D, Campbell EA, Nickels BE, Thomas MS, Darst SA, Westblade LF
Protein Sci. 2011 Jun;20(6):986-95. doi: 10.1002/pro.622. Epub 2011 Apr 26.