Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Lenti_MCP-LSD1_Hygro
(Plasmid #138457)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plenti
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LSD1
  • Insert Size (bp)
    2556
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGATCTTGGTTCATTCTCAAGC
  • 3′ sequencing primer NA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti_MCP-LSD1_Hygro was a gift from Jian Xu (Addgene plasmid # 138457 ; http://n2t.net/addgene:138457 ; RRID:Addgene_138457)
  • For your References section:

    Interrogation of enhancer function by enhancer-targeting CRISPR epigenetic editing. Li K, Liu Y, Cao H, Zhang Y, Gu Z, Liu X, Yu A, Kaphle P, Dickerson KE, Ni M, Xu J. Nat Commun. 2020 Jan 24;11(1):485. doi: 10.1038/s41467-020-14362-5. 10.1038/s41467-020-14362-5 PubMed 31980609