QQR1 variant
(Plasmid
#138564)
-
PurposeExpresses human codon-optimized SpCas9-QQR1 and blasticidin resistance: EFS promoter-QQR1-NLS-FLAG-P2A-BSD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 138564 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
- Total vector size (bp) 12859
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQQR1
-
Alt nameQQR1 variant
-
SpeciesSynthetic
-
Insert Size (bp)4641
-
MutationG1218R, N1286Q, I1331F, D1332K, R1333Q, R1335Q, T1337R
- Promoter EFS
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- FLAG (C terminal on insert)
- BSD (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer 5' - ggtcttgaaaggagtgggaattgg - 3'
- 3′ sequencing primer 5' - CAGGTCGCTTGTCGCCTCC - 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
QQR1 variant was a gift from Hyongbum Kim (Addgene plasmid # 138564 ; http://n2t.net/addgene:138564 ; RRID:Addgene_138564) -
For your References section:
Prediction of the sequence-specific cleavage activity of Cas9 variants. Kim N, Kim HK, Lee S, Seo JH, Choi JW, Park J, Min S, Yoon S, Cho SR, Kim HH. Nat Biotechnol. 2020 Nov;38(11):1328-1336. doi: 10.1038/s41587-020-0537-9. Epub 2020 Jun 8. 10.1038/s41587-020-0537-9 PubMed 32514125