pEGFP - FLAG-APEX2- hs Lamin B1
(Plasmid #139442)

• Purpose: APEX2-Lamin B1 expression plasmid
• Depositing Lab: Yixian Zheng
• Publication: Tran et al bioRxiv 2020.02.05.935635

Backbone

• Vector backbone: Alice Ting (Addgene plasmid # 66171
• Backbone size w/o insert (bp): 4026
• Total vector size (bp): 6582
• Modifications to backbone: This backbone comes from Addgene #66171
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: LMNB1
• Alt name: Lamin B1
• Species: H. sapiens (human)
• Insert Size (bp): 1761
• Entrez Gene: LMNB1 (a.k.a. ADLD, LMN, LMN2, LMNB, MCPH26)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (N terminal on backbone)
  • APEX2
  • 3xGGGGS linker (between APEX2 and Lamin B1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GACCTCGGGCTCGGGCTCC
• 3′ sequencing primer: CCTCAGCCACTGGAAATGTT

Resource Information

• Supplemental Documents:
  • pEGFP_APEX2_hs_Lamin_B1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The parent backbone is from Alice Ting (Addgene plasmid # 66171; Lam et al Nat Methods. 2014 Nov 24. doi: 10.1038/nmeth.3179). This backbone was digested with BamHI and XhoI. The human Lmnb1 cDNA was amplified with a 5' primer containing the XhoI site and a 3x GGGGS linker. The 3' primer contained the BamHI site.

Please visit https://www.biorxiv.org/content/10.1101/2020.02.05.935635v1 for bioRxiv preprint.