pTF-R
(Plasmid #139669)

• Purpose: Expression cassette for R recombinase in T-DNA vector
• Depositing Lab: James Birchler
• Publication: Recombinase Expression Plasmids and Anti-DsRed test constructs for expression plasmids (unpublished)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	139669	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pTF101
  (Search Vector Database)
• Backbone size w/o insert (bp): 9189
• Total vector size (bp): 12590
• Vector type: Plant Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: R recombinase
• Species: Synthetic
• Insert Size (bp): 1472
• Promoter: Maize Ubiquitin

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATGCTCACCCTGTTGTTTGGTGT
• 3′ sequencing primer: gttttcccagtcacgacgtt

Resource Information

• Supplemental Documents:
  • pTF-R.gbk
• Terms and Licenses:
  • UBMTA
• Industry Terms:
  • Not Available to Industry