-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4709
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMitotic Centromere Associated Kinesin
-
Alt nameMCAK
-
Alt nameKif2C
-
Alt nameKinesin 13
-
SpeciesCricetulus griseus (Chinese hamster)
-
Insert Size (bp)2238
-
GenBank IDU11790
-
Tags
/ Fusion Proteins
- GFP (N terminal on backbone)
- His (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer catggtcctgctggagttcgtg
- 3′ sequencing primer TTTTAAAGCAAGTAAAACCTCTACAAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYOY152 was a gift from Linda Wordeman (Addgene plasmid # 13987 ; http://n2t.net/addgene:13987 ; RRID:Addgene_13987) -
For your References section:
K-loop insertion restores microtubule depolymerizing activity of a "neckless" MCAK mutant. Ovechkina Y, Wagenbach M, Wordeman L. J Cell Biol. 2002 Nov 25. 159(4):557-62. 10.1083/jcb.200205089 PubMed 12446739