Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCEFL GAL4dbd-KLF4 159-329
(Plasmid #140148)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140148 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCEFL
  • Total vector size (bp) 7012
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KLF4 aa 159-329
  • Species
    H. sapiens (human)
  • Mutation
    Deleted amino acids 1 to 158 and 330 to 479
  • GenBank ID
    NM_004235
  • Entrez Gene
    KLF4 (a.k.a. EZF, GKLF)
  • Promoter EF1a
  • Tag / Fusion Protein
    • GAL4dbd (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCG
  • 3′ sequencing primer ATT TAG GTG ACA CTA TAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCEFL GAL4dbd-KLF4 159-329 was a gift from Ramiro Iglesias-Bartolome (Addgene plasmid # 140148 ; http://n2t.net/addgene:140148 ; RRID:Addgene_140148)
  • For your References section:

    YAP1/TAZ-TEAD transcriptional networks maintain skin homeostasis by regulating cell proliferation and limiting KLF4 activity. Yuan Y, Park J, Feng A, Awasthi P, Wang Z, Chen Q, Iglesias-Bartolome R. Nat Commun. 2020 Mar 19;11(1):1472. doi: 10.1038/s41467-020-15301-0. 10.1038/s41467-020-15301-0 PubMed 32193376