pLVX-BSD-tet-mEGFP-MIB1
(Plasmid
#140241)
-
PurposeLentiviral vector expressing mEGFP-tagged MIB1 upon tetracycline treatment
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 140241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLVX-BSD-tet
- Backbone size w/o insert (bp) 8011
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTet-inducible mEGFP-MIB1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3821
-
Entrez GeneMIB1 (a.k.a. DIP-1, DIP1, LVNC7, MIB, ZZANK2, ZZZ6)
- Promoter TRE
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TATGTCGAGGTAGGCGTGTA
- 3′ sequencing primer ctctaggcaccggatcaatt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-BSD-tet-mEGFP-MIB1 was a gift from Urs Greber (Addgene plasmid # 140241 ; http://n2t.net/addgene:140241 ; RRID:Addgene_140241) -
For your References section:
The E3 Ubiquitin Ligase Mind Bomb 1 Controls Adenovirus Genome Release at the Nuclear Pore Complex. Bauer M, Flatt JW, Seiler D, Cardel B, Emmenlauer M, Boucke K, Suomalainen M, Hemmi S, Greber UF. Cell Rep. 2019 Dec 17;29(12):3785-3795.e8. doi: 10.1016/j.celrep.2019.11.064. 10.1016/j.celrep.2019.11.064 PubMed 31851912