Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pmCherry-U6-CLIC3
(Plasmid #140583)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 140583 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmCherry-U6
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA CLIC3
  • gRNA/shRNA sequence
    GACAGACACGCTGCAGATCG
  • Species
    Synthetic

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-U6-CLIC3 was a gift from Feng Zhang (Addgene plasmid # 140583 ; http://n2t.net/addgene:140583 ; RRID:Addgene_140583)
  • For your References section:

    Highly Parallel Profiling of Cas9 Variant Specificity. Schmid-Burgk JL, Gao L, Li D, Gardner Z, Strecker J, Lash B, Zhang F. Mol Cell. 2020 Mar 17. pii: S1097-2765(20)30143-X. doi: 10.1016/j.molcel.2020.02.023. 10.1016/j.molcel.2020.02.023 PubMed 32187529