pCRISPRx-Sth1Cas9-L5
(Plasmid #140993)

• Purpose: Sth1Cas9, TetR, KanR, L5Int, attP to create frameshifts and gene deletion in Mycobacteria
• Depositing Lab: Wilbert Bitter
• Publication: Meijers et al Tuberculosis (Edinb). 2020 Sep;124:101983. doi: 10.1016/j.tube.2020.101983. Epub 2020 Aug 12.

Backbone

• Vector backbone: PLJR962
• Backbone manufacturer: custom design
• Total vector size (bp): 8881
• Vector type: Unspecified ; integrative in mycobactreia

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Sth1Cas9
• Alt name: type II CRISPR RNA-guided endonuclease Cas9
• Alt name: Streptococcus thermophilus LMD-9
• Species: Streptococcus thermophilus
• Insert Size (bp): 3366
• GenBank ID:

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: gtctgaccagggaaaatag

Gene/Insert 2

• Gene/Insert name: TetR
• Insert Size (bp): 624

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GGCGAGTTTACGGGTTGTTA

Gene/Insert 3

• Gene/Insert name: L5 attP
• Insert Size (bp): 43

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: ATGGCTCATAACACCCCTTG

Gene/Insert 4

• Gene/Insert name: L5 Int
• Insert Size (bp): 1116

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: ATGGCTCATAACACCCCTTG

Gene/Insert 5

• Gene/Insert name: KanR
• Insert Size (bp): 816

Cloning Information for Gene/Insert 5

• Cloning method: Unknown
• 5′ sequencing primer: ATCGCGAGCCCATTTATACC

Resource Information

• Supplemental Documents:
  • pCRISPRx-Sth1Cas9-L5.gb
• A portion of this plasmid was derived from a plasmid made by: Sarah Fortune and Jeremy Rock

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry