Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pCAG-scFvGCN4sfGFP-VP64-GB1
(Plasmid #141417)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 141417 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    scFvGCN4sfGFP-VP64-GB1
  • Insert Size (bp)
    2031
  • GenBank ID
    LC169511
  • Promoter CAG
  • Tags / Fusion Proteins
    • sfGFP
    • HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer caaaccacaactagaatgcag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-scFvGCN4sfGFP-VP64-GB1 was a gift from Izuho Hatada (Addgene plasmid # 141417 ; http://n2t.net/addgene:141417 ; RRID:Addgene_141417)
  • For your References section:

    Synergistic Upregulation of Target Genes by TET1 and VP64 in the dCas9-SunTag Platform. Morita S, Horii T, Kimura M, Hatada I. Int J Mol Sci. 2020 Feb 25;21(5). pii: ijms21051574. doi: 10.3390/ijms21051574. 10.3390/ijms21051574 PubMed 32106616