EGFP-CCHD (p130Cas)
(Plasmid
#145132)
-
PurposeExpresses CCH domain from p130Cas with an EGFP tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 145132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP
- Total vector size (bp) 5172
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep130Cas CCH domain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)483
-
Entrez GeneBCAR1 (a.k.a. CAS, CAS1, CASS1, CRKAS, P130Cas)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer GGCTGATTATGATCAGTTATCTAGATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-CCHD (p130Cas) was a gift from Johanna Ivaska (Addgene plasmid # 145132 ; http://n2t.net/addgene:145132 ; RRID:Addgene_145132) -
For your References section:
Filopodome Mapping Identifies p130Cas as a Mechanosensitive Regulator of Filopodia Stability. Jacquemet G, Stubb A, Saup R, Miihkinen M, Kremneva E, Hamidi H, Ivaska J. Curr Biol. 2019 Jan 21;29(2):202-216.e7. doi: 10.1016/j.cub.2018.11.053. Epub 2019 Jan 10. 10.1016/j.cub.2018.11.053 PubMed 30639111