-
PurposePlasmid for the aTc-inducible expression of the large-fragment of Bst DNAP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 145799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepAtetO
-
Backbone manufacturermodified from pASK-IBA37plus (IBA GmbH)
-
Modifications to backboneRemoval of 6xHis tag, multiple cloning site, and Rop gene from pASK-IBA37plus
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBst-LF
-
Alt nameLarge-fragment Bst DNAP
-
Alt nameBst(exo-)
-
SpeciesGeobacillus stearothermophilus
-
Insert Size (bp)1827
- Promoter tet PA
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACAGACCCTAATTTCACATCATATGAC
- 3′ sequencing primer CCGACGAACTAAAACGCTTGAGGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Terms and Licenses
-
Industry Terms
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAtetO_6xHis-Bst-LF was a gift from Andrew Ellington (Addgene plasmid # 145799 ; http://n2t.net/addgene:145799 ; RRID:Addgene_145799) -
For your References section:
High-surety isothermal amplification and detection of SARS-CoV-2, including with crude enzymes. Bhadra S, Riedel TE, Lakhotia S, Tran ND, Ellington AD. bioRxiv 2020.04.13.039941 10.1101/2020.04.13.039941