Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-tMCK-ER-TurboID
(Plasmid #149412)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149412 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV
  • Total vector size (bp) 6072
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ER-TurboID
  • Insert Size (bp)
    1116
  • Promoter tMCK
  • Tags / Fusion Proteins
    • V5 (C terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aaactgggcttgtcgagaca
  • 3′ sequencing primer gcagcgtatccacatag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-tMCK-ER-TurboID was a gift from Jonathan Long (Addgene plasmid # 149412 ; http://n2t.net/addgene:149412 ; RRID:Addgene_149412)
  • For your References section:

    Cell type-selective secretome profiling in vivo. Wei W, Riley NM, Yang AC, Kim JT, Terrell SM, Li VL, Garcia-Contreras M, Bertozzi CR, Long JZ. Nat Chem Biol. 2021 Mar;17(3):326-334. doi: 10.1038/s41589-020-00698-y. Epub 2020 Nov 16. 10.1038/s41589-020-00698-y PubMed 33199915