prk5-MFSD12-TEV-3xFLAG-3xHA PM mutant
(Plasmid #149507)

• Purpose: Transient expression of human MFSD12 with recoded nucleotide sequence. Dileucine motif LL256-257 has been mutated to AA.
• Depositing Lab: David Sabatini
• Publication: Adelmann et al Nature. 2020 Nov 18. pii: 10.1038/s41586-020-2937-x. doi: 10.1038/s41586-020-2937-x.

Backbone

• Vector backbone: prk5
• Backbone size w/o insert (bp): 5000
• Vector type: Mammalian Expression ; Transient Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MFSD12
• Alt name: C19orf28
• Species: H. sapiens (human)
• Insert Size (bp): 1440
• Mutation: Codon Optimized Sequence, p.LL256-257AA
• Entrez Gene: MFSD12 (a.k.a. C19orf28, PP3501)
• Promoter: CMV
• Tag / Fusion Protein:
  • TEV-3XHA-3XFLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACGATTTAGGTGACACTATAG

Resource Information

• Supplemental Documents:
  • prk5_mfsd12_tev3xflag3xha_pm_mutant.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry