RCAS DNhRARalpha (CC#1865)
(Plasmid
#15153)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneRCASBP (A)
- Backbone size w/o insert (bp) 11600
-
Vector typeRetroviral ; Avian expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRAR alpha (dom neg)
-
Alt nameRARa
-
SpeciesH. sapiens (human)
-
MutationDominant negative. Truncated at aa403, so lacks the C-terminal transcriptional activation domain.
-
Entrez GeneRARA (a.k.a. NR1B1, RAR, RARalpha)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRAR alpha provided by Dr. Ronald Evans.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RARa was PCR-amplified using GCAGAAGACCCCATGGCCAGCAACAGCAGCTCCT as the 5' primer and CCGGAATTCCAACATTTCCTGGATGAGAGGCGG as the 3' primer. The PCR product was digested with BbsI and EcoRI, and subcloned into the NcoI/EcoRI sites of pSlax21 to generate pSlax21-DNhRAR. The ClaI fragment of pSlax21-DNhRAR was then subcloned into the RCASBP(A) vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCAS DNhRARalpha (CC#1865) was a gift from Connie Cepko (Addgene plasmid # 15153 ; http://n2t.net/addgene:15153 ; RRID:Addgene_15153) -
For your References section:
Retinoic acid regulates the expression of dorsoventral topographic guidance molecules in the chick retina. Sen J, Harpavat S, Peters MA, Cepko CL. Development. 2005 Dec . 132(23):5147-59. 10.1242/dev.02100 PubMed 16251210