1
Plasmid 15249: pMKO.1-Puro-shPP2A-Aalpha
  • PP2A regulatory subunit A, alpha isoform

  • PP2A A alpha

  • 58

  • H. sapiens (human)

  • PPP2R1A (PP2A-Aalpha, PP2AAALPHA, PR65A)

  • pMKO.1
    (Search Vector Database)

  • Mammalian Expression, Retroviral, RNAi

  • 6700

  • AgeI

  • No

  • EcoRI

  • No

  • pLXSN 5' List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • William Hahn

  • MTA

Comments: 

Target sequence: GACAACAGCACCTTGCAGAGT

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: The tumor suppressor PP2A Abeta regulates the RalA GTPase. Sablina et al (Cell. 2007 Jun 1. 129(5):969-82. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 15249" in your Materials and Methods section.