pX459-CTNNB1-ATG
(Plasmid
#153429)
-
PurposeExpresses a gRNA that overlaps the startcodon of human CTNNB1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153429 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSpCas9(BB)-2A-Puro (PX459) V2.0 (Feng Zhang, Plasmid #62988)
- Backbone size w/o insert (bp) 9158
- Total vector size (bp) 9178
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCTNNB1 gRNA
-
gRNA/shRNA sequenceTGAGTAGCCATTGTCCACGC
-
SpeciesH. sapiens (human)
-
Entrez GeneCTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6 FWD (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.05.28.120543v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-CTNNB1-ATG was a gift from Renee van Amerongen (Addgene plasmid # 153429 ; http://n2t.net/addgene:153429 ; RRID:Addgene_153429) -
For your References section:
Quantitative live-cell imaging and computational modeling shed new light on endogenous WNT/CTNNB1 signaling dynamics. de Man SM, Zwanenburg G, van der Wal T, Hink MA, van Amerongen R. Elife. 2021 Jun 30;10. pii: 66440. doi: 10.7554/eLife.66440. 10.7554/eLife.66440 PubMed 34190040