mOrange-P2A-hKvb1
(Plasmid
#154084)
-
PurposeIndependent expression of mOrange and human Kvbeta 1 under human synapsin 1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4579
- Total vector size (bp) 6559
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemOrange-P2A-human Kvb1
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1980
-
GenBank IDNM172159.2
-
Entrez GeneKCNAB1 (a.k.a. AKR6A3, KCNA1B, KV-BETA-1, Kvb1.3, hKvBeta3, hKvb3)
- Promoter human synapsin 1
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAAACTCCCCTTCCCGGCCA
- 3′ sequencing primer ggcattaaagcagcgtatcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mOrange-P2A-hKvb1 was a gift from Michael Hoppa (Addgene plasmid # 154084 ; http://n2t.net/addgene:154084 ; RRID:Addgene_154084)