KRAS-A146T
(Plasmid #154426)

• Purpose: A146T Kras with Flag tag inserted into N-terminal domain between 6Xhis tag and TEV cleavage site.
• Depositing Lab: Kenneth Westover
• Publication: Poulin et al Cancer Discov. 2019 Jun;9(6):738-755. doi: 10.1158/2159-8290.CD-18-1220. Epub 2019 Apr 5.

Backbone

• Vector backbone: pDNA2.0
• Backbone manufacturer: ATUM
• Backbone size w/o insert (bp): 3939
• Total vector size (bp): 4500
• Modifications to backbone: None
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KRAS
• Alt name: Kirsten ras oncogene
• Species: H. sapiens (human)
• Insert Size (bp): 507
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: T5
• Tags / Fusion Proteins:
  • 6xHis-tag
  • TEV protease cleavage sequence

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAATTGTGAGCGCTCACAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry