Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pk-myc-Par6A
(Plasmid #15472)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15472 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pKmyc
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Partitioning-defective protein 6A
  • Alt name
    Par6A
  • Alt name
    PAR-6A
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1148
  • GenBank ID
    AF252290
  • Entrez Gene
    Pard6g (a.k.a. 2410049N21Rik, Par6a)
  • Tag / Fusion Protein
    • Myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer CAGGTCCAACTGCACCTCGGTTC
  • 3′ sequencing primer TTTGTGATGCTATTGCTTTATTTG TA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pk-myc-Par6A was a gift from Ian Macara (Addgene plasmid # 15472 ; http://n2t.net/addgene:15472 ; RRID:Addgene_15472)
  • For your References section:

    The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Joberty G, Petersen C, Gao L, Macara IG. Nat Cell Biol 2000 Aug;2(8):531-9. 10.1038/35019573 PubMed 10934474