pQC-FsCFP-mCherryFP
(Plasmid
#154836)
-
PurposeFrame-shift fluorescent reporter for genomic DNA editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepQC-XIG
- Backbone size w/o insert (bp) 7116
- Total vector size (bp) 7700
-
Modifications to backboneThe nucleotide sequence consisting of Cerulan fluorescent protein (CFP), IRES and mCherryFP and flanked with NotI and EcoRV restriction sites was synthesized by using the service of Genscript, NJ
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametargeting sequence of VEGF
-
Alt nameVascular endothelial growth factor
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Not1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer AGAGCTCGTTTAGTGAACCGTC
- 3′ sequencing primer TAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid contains "VEGF target sequence" cloned between Not1 and Xho1 restriction sites. People who receive this plasmid can simply digest the vector with Not1 and Xho1 to get rid of VEGF sequence and insert their target sequence for their gene of interest.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQC-FsCFP-mCherryFP was a gift from Fangliang Zhang (Addgene plasmid # 154836 ; http://n2t.net/addgene:154836 ; RRID:Addgene_154836) -
For your References section:
Insertion/deletion-activated frame-shift fluorescence protein is a sensitive reporter for genomic DNA editing. Kumar A, Birnbaum MD, Moorthy BT, Singh J, Palovcak A, Patel DM, Zhang F. BMC Genomics. 2019 Jul 24;20(1):609. doi: 10.1186/s12864-019-5963-z. 10.1186/s12864-019-5963-z PubMed 31340764