pQC-FsCFP-mCherryFP
(Plasmid #154836)

• Purpose: Frame-shift fluorescent reporter for genomic DNA editing
• Depositing Lab: Fangliang Zhang
• Publication: Kumar et al BMC Genomics. 2019 Jul 24;20(1):609. doi: 10.1186/s12864-019-5963-z.

Backbone

• Vector backbone: pQC-XIG
• Backbone size w/o insert (bp): 7116
• Total vector size (bp): 7700
• Modifications to backbone: The nucleotide sequence consisting of Cerulan fluorescent protein (CFP), IRES and mCherryFP and flanked with NotI and EcoRV restriction sites was synthesized by using the service of Genscript, NJ
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: targeting sequence of VEGF
• Alt name: Vascular endothelial growth factor
• Insert Size (bp): 20

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Not1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: AGAGCTCGTTTAGTGAACCGTC
• 3′ sequencing primer: TAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTAGCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid contains "VEGF target sequence" cloned between Not1 and Xho1 restriction sites. People who receive this plasmid can simply digest the vector with Not1 and Xho1 to get rid of VEGF sequence and insert their target sequence for their gene of interest.