Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CaMKII-somBiPOLES-mCerulean
(Plasmid #154948)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 154948 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV5 154948-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405
AAV9 154948-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405
AAV Retrograde 154948-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 3779
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    somBiPOLES
  • Species
    Synthetic
  • Insert Size (bp)
    3273
  • Promoter CaMKIIa(0.4)
  • Tag / Fusion Protein
    • soma-targeting motif from Kv2.1 channel (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CAGGGCAAAGAGGAGCAGG
  • 3′ sequencing primer ATACAGAGGCATTAAAGCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2) . Please visit https://www.biorxiv.org/content/10.1101/2020.07.15.204347v1 for bioRxiv preprint.

Information for AAV5 (Catalog # 154948-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA.

CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCerulean

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV9 (Catalog # 154948-AAV9) ( Back to top )

Purpose

Ready-to-use AAV9 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA.

CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCerulean

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 154948-AAVrg) ( Back to top )

Purpose

Ready-to-use AAV Retrograde particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA.

CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCerulean

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CaMKII-somBiPOLES-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 154948 ; http://n2t.net/addgene:154948 ; RRID:Addgene_154948)

    For viral preps, please replace (Addgene plasmid # 154948) in the above sentence with: (Addgene viral prep # 154948-AAV5), (Addgene viral prep # 154948-AAV9), or (Addgene viral prep # 154948-AAVrg)

  • For your References section:

    BiPOLES is an optogenetic tool developed for bidirectional dual-color control of neurons. Vierock J, Rodriguez-Rozada S, Dieter A, Pieper F, Sims R, Tenedini F, Bergs ACF, Bendifallah I, Zhou F, Zeitzschel N, Ahlbeck J, Augustin S, Sauter K, Papagiakoumou E, Gottschalk A, Soba P, Emiliani V, Engel AK, Hegemann P, Wiegert JS. Nat Commun. 2021 Jul 26;12(1):4527. doi: 10.1038/s41467-021-24759-5. 10.1038/s41467-021-24759-5 PubMed 34312384