pGTag-P2A-QFGal4-SV40pA
(Plasmid
#155127)
-
PurposeDonor for precise CRISPR directed genomic integration of QFGal4 using the GeneWeld method
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 155127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepK
-
Backbone manufacturerKarl J. Clark
- Backbone size w/o insert (bp) 3310
- Total vector size (bp) 4390
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP2A-QFGal4
-
SpeciesS. cerevisiae (budding yeast); Neurospora crassa
-
Insert Size (bp)1080
-
GenBank ID855828 3875756
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer GCATGGATGTTTTCCCAGTC
- 3′ sequencing primer atggctcataacaccccttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pGTag series vectors were described in PMID: 32412410. pGTag-P2A-QFGal4-SV40 was modified from pGTag-eGFP-SV40 (Plasmid #117813).
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGTag-P2A-QFGal4-SV40pA was a gift from Bret Pearson (Addgene plasmid # 155127 ; http://n2t.net/addgene:155127 ; RRID:Addgene_155127) -
For your References section:
An optimized QF-binary expression system for use in zebrafish. Burgess J, Burrows JT, Sadhak R, Chiang S, Weiss A, D'Amata C, Molinaro AM, Zhu S, Long M, Hu C, Krause HM, Pearson BJ. Dev Biol. 2020 Jul 19. pii: S0012-1606(20)30202-5. doi: 10.1016/j.ydbio.2020.07.007. 10.1016/j.ydbio.2020.07.007 PubMed 32697972
Map uploaded by the depositor.
