-
PurposeExpress full-length human YTHDF1 with a C-terminal SNAP-tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSNAPf
-
Backbone manufacturerNew England Biolabs
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYTHDF1
-
SpeciesH. sapiens (human)
-
GenBank IDCCDS13511.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer T7: TAATACGACTCACTATAG
- 3′ sequencing primer pSNAPf-SeqR: GGAGTACTCACCCCAACAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSNAPf-hYTHDF1 was a gift from Xiaowei Zhuang (Addgene plasmid # 155346 ; http://n2t.net/addgene:155346 ; RRID:Addgene_155346) -
For your References section:
m(6)A-binding YTHDF proteins promote stress granule formation. Fu Y, Zhuang X. Nat Chem Biol. 2020 May 25. pii: 10.1038/s41589-020-0524-y. doi: 10.1038/s41589-020-0524-y. 10.1038/s41589-020-0524-y PubMed 32451507