pLentiCMVblast_SLC38A2_wt
(Plasmid #156180)

• Purpose: CMV-driven expression of sgRNA-resistant SLC38A2 wild-type cDNA.
• Depositing Lab: Alec Kimmelman
• Publication: Parker et al Cancer Discov. 2020 Apr 27. pii: 2159-8290.CD-19-0959. doi: 10.1158/2159-8290.CD-19-0959.

Backbone

• Vector backbone: pLenti CMV Blast DEST
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 9216
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SLC38A2
• Alt name: SNAT2
• Species: H. sapiens (human)
• Insert Size (bp): 1521
• Mutation: Silent mutations to prevent targeting by sgRNA sequence: TAATCTGAGCAATGCGATTG
• GenBank ID: BC040342.1
• Entrez Gene: SLC38A2 (a.k.a. ATA2, PRO1068, SAT2, SNAT2)
• Promoter: CMV

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • pLentiCMVblast_resSLC38A2_WT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Silent mutations are as follows: aat ctg agc aat gcg att gtg ggc agt --> AAC TTG TCC AAC GCA ATC GTT GGT TCT.