Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pRetrosuper USP28 shRNA-3
(Plasmid #15664)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15664 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRetrosuper
  • Backbone size w/o insert (bp) 6400
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    USP28 shRNA
  • Alt name
    USP28
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    64
  • Entrez Gene
    USP28

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII? (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

hairpin targets the sequence: GTATGGACAAGAGCGTTGGT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRetrosuper USP28 shRNA-3 was a gift from Martin Eilers (Addgene plasmid # 15664 ; http://n2t.net/addgene:15664 ; RRID:Addgene_15664)
  • For your References section:

    The ubiquitin-specific protease USP28 is required for MYC stability. Popov N, Wanzel M, Madiredjo M, Zhang D, Beijersbergen R, Bernards R, Moll R, Elledge SJ, Eilers M. Nat Cell Biol. 2007 Jul . 9(7):765-74. 10.1038/ncb1601 PubMed 17558397