pBABE YAP1
(Plasmid #15682)

• Depositing Lab: Joan Brugge
• Publication: Overholtzer et al Proc Natl Acad Sci U S A. 2006 Aug 15. 103(33):12405-10.

Backbone

• Vector backbone: pBABE puro
• Backbone manufacturer: Available at Addgene (#1764)
• Backbone size w/o insert (bp): 5169
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: YAP
• Species: H. sapiens (human)
• Entrez Gene: YAP1 (a.k.a. COB1, YAP, YAP-1, YAP2, YAP65, YKI)
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pBABE 5'

Resource Information

• Articles Citing this Plasmid:
  • 15 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The human YAP ORF was cloned into the pBABEpuro vector as an EcoRI–BamHI fragment. A single FLAG tag was added to the N terminus during PCR with the following primers: Hs.YAP.F, CCGGGATCCACCATGGATTACAAGGATGACGACGATAAGATGGACCCCGGGCAGCAGCCCGCCGC; and Hs.YAP.R, CCGGAATTCCTATAACCATGTAAGAAAGCTTTC.