pSBBi-Pur LaG17-synNotch-TetRVP64
(Plasmid #158133)

• Purpose: Constitutive expression of anti-GFP nanobody (LaG-17) synNotch TetRVP64 receptor in a pSBBi-Pur Sleeping Beauty backbone
• Depositing Lab: Neal Devaraj
• Publication: Methylxanthine Synthesis in Human Cells (unpublished)

Backbone

• Vector backbone: pSBBi-Pur
• Total vector size (bp): 7903
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LaG17-synNotch-TetRVP64
• Alt name: anti-GFP synNotch TetRVP64
• Species: Synthetic
• Insert Size (bp): 2223
• Promoter: EF1α

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Wendell Lim lab Morsut et al Cell. 2016 Feb 11;164(4):780-91. doi: 10.1016/j.cell.2016.01.012. Epub 2016 Jan 28.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

SB-transposon with constitutive bi-directional promoter. One side contains anti-GFP LaG17-synNotch-Gal4VP64; the other side contains puromycin resistance .