pLenti-hSyn-Gαq*-BERKY1
(Plasmid
#158430)
-
PurposeBRET biosensor for detection of Gαq-GTP in lentiviral vector pLenti-hSyn
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 158430 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti-hSynapsin-Cre-WPRE (Addgene Plasmid #86641)
- Backbone size w/o insert (bp) 9434
- Total vector size (bp) 10563
-
Modifications to backboneAgeI-Cre-EcoRI removed during cloning
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLyn11-Nluc-ER/K linker-YFP-GRK2(RH)
-
Alt nameGaq*-BERKY1
-
Insert Size (bp)2110
- Promoter hSynapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI, replaced with NheI/GCCACC (destroyed during cloning)
- 3′ cloning site EcoRI, replaced with XbaI/AgeI (destroyed during cloning)
- 5′ sequencing primer gcagcggaggagtcgtgtcg
- 3′ sequencing primer ccacatagcgtaaaaggagc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hSyn-Gαq*-BERKY1 was a gift from Mikel Garcia-Marcos (Addgene plasmid # 158430 ; http://n2t.net/addgene:158430 ; RRID:Addgene_158430) -
For your References section:
Revealing the Activity of Trimeric G-proteins in Live Cells with a Versatile Biosensor Design. Maziarz M, Park JC, Leyme A, Marivin A, Garcia-Lopez A, Patel PP, Garcia-Marcos M. Cell. 2020 Jun 27. pii: S0092-8674(20)30752-2. doi: 10.1016/j.cell.2020.06.020. 10.1016/j.cell.2020.06.020 PubMed 32634377