Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMSCVpuro-Cas9-EGFP
(Plasmid #159126)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 159126 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMSCVpuro
  • Total vector size (bp) 11222
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9 fused to EGFP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4926
  • Promoter MSCV LTR promoter
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcgttcgacc
  • 3′ sequencing primer cagcggggctgctaaagcgcatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the the M13R primer region is missing compared to the original depositor's sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCVpuro-Cas9-EGFP was a gift from Taekjip Ha (Addgene plasmid # 159126 ; http://n2t.net/addgene:159126 ; RRID:Addgene_159126)
  • For your References section:

    Very fast CRISPR on demand. Liu Y, Zou RS, He S, Nihongaki Y, Li X, Razavi S, Wu B, Ha T. Science. 2020 Jun 12;368(6496):1265-1269. doi: 10.1126/science.aay8204. 10.1126/science.aay8204 PubMed 32527834