pQdCas9-sgempty
(Plasmid #159523)

• Purpose: Expression of dCas9 driven by lux cassette from Vibrio fischeri
• Depositing Lab: Radhakrishnan Mahadevan
• Publication: Liu et al ACS Synth Biol. 2020 Jun 5. doi: 10.1021/acssynbio.0c00148.

Backbone

• Vector backbone: pBBRMCS2
• Vector type: CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: the plasmid is stable in both 30 and 37 centigrade in E. coli. the plasmid is stable in 30 centigrade in P. putida.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: quorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dcas9 and sgRNA
• Species: Synthetic
• Insert Size (bp): 6000
• Promoter: quorum sensing promoter

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AGGATCTCGTCGTGACCCATG
• 3′ sequencing primer: AAACGGAGGAATGGGAACG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry