pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235)
(Plasmid
#160646)
-
PurposeModule for the constitutive expression of the nptII, Cas9 and DsRed genes.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160646 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGB3_omega1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typeCRISPR
-
Selectable markerslacZ
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametNos:nptII:PNos-P35s:Cas9:tNos-P35s:DsRed:tNos
-
SpeciesUnspecified
-
Insert Size (bp)9357
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos, 35S, 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 omega1 Tnos:nptII:Pnos - P35S:Cas9:Tnos - P35S:DsRed:Tnos (GB2235) was a gift from Diego Orzaez (Addgene plasmid # 160646 ; http://n2t.net/addgene:160646 ; RRID:Addgene_160646)