Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGB3 omega1 Tnos:BASTA:Pnos - P35S:hCas9:Tnos (GB3469)
(Plasmid #160647)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160647 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDGB3_omega1
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BASTA / Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    6830
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter Pnos, P35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer caacctctcgggcttctgga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsaI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGB3 omega1 Tnos:BASTA:Pnos - P35S:hCas9:Tnos (GB3469) was a gift from Diego Orzaez (Addgene plasmid # 160647 ; http://n2t.net/addgene:160647 ; RRID:Addgene_160647)