pHR_PGK-hACE2
(Plasmid #161612)

• Purpose: Expression of human ACE2 in mammalian cells
• Depositing Lab: Brad Rosenberg
• Publication: Daniloski et al Cell. 2020 Oct 24. pii: S0092-8674(20)31394-5. doi: 10.1016/j.cell.2020.10.030.

Backbone

• Vector backbone: pHR_PGK
• Backbone size w/o insert (bp): 9014
• Total vector size (bp): 11432
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Angiotensin-converting enzyme 2
• Alt name: ACE2
• Species: H. sapiens (human)
• Insert Size (bp): 2418
• GenBank ID: NM_021804
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: PGK

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTTCAAAAGCGCACGTCTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pHR_PGK-hACE2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry