pAAV-hSyn-mRuby3-6xFLAG
(Plasmid
#161613)
-
PurposeCell morphology marker construct. Contains a red fluorescent protein mRuby3 and six FLAG tags.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-hSyn
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4496
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRuby3-6xFLAG
-
Alt name3xFLAG-mRuby3-3xFLAG
-
Alt namesmRuby3_FLAG
-
SpeciesSynthetic
-
Insert Size (bp)900
-
MutationN/A
- Promoter Human synapsin 1 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCACGGGCGCGACCATCTGC
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The fluorescence of mRuby3 will be preserved after formaldehyde fixation. The pAAV-hSyn backbone contains WHP Posttranscriptional Response Element (WPRE) at 3'-UTR.
5' cloning site: EcoRI (not destroyed), 3' cloning site: HindIII (not destroyed).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-mRuby3-6xFLAG was a gift from Edward Boyden (Addgene plasmid # 161613 ; http://n2t.net/addgene:161613 ; RRID:Addgene_161613) -
For your References section:
Spatial Multiplexing of Fluorescent Reporters for Imaging Signaling Network Dynamics. Linghu C, Johnson SL, Valdes PA, Shemesh OA, Park WM, Park D, Piatkevich KD, Wassie AT, Liu Y, An B, Barnes SA, Celiker OT, Yao CC, Yu CJ, Wang R, Adamala KP, Bear MF, Keating AE, Boyden ES. Cell. 2020 Nov 17. pii: S0092-8674(20)31399-4. doi: 10.1016/j.cell.2020.10.035. 10.1016/j.cell.2020.10.035 PubMed 33232692