pTF-ACE2s
(Plasmid #162786)

• Purpose: The extracellular domain of Angiotensin converting enzyme 2 (ACE2) expression
• Depositing Lab: Ivan Vorobiev
• Publication: Kolesov et al Diagnostics (Basel). 2022 Feb 3;12(2). pii: diagnostics12020393. doi: 10.3390/diagnostics12020393.

Backbone

• Vector backbone: p1.1
• Backbone manufacturer: LMBT, LTD
• Backbone size w/o insert (bp): 11914
• Total vector size (bp): 7436
• Modifications to backbone: Truncated EEF1A1 DFR and UFR sequences; FLAG-tag and 10xHis-tag coding sequences added
• Vector type: Mammalian Expression
• Selectable markers: HT/MTX

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Angiotensin-converting enzyme 2
• Alt name: ACE-2
• Species: H. sapiens (human)
• Insert Size (bp): 2235
• GenBank ID: NM_021804
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
• Tags / Fusion Proteins:
  • hTPA leader (N terminal on insert)
  • FLAG (C terminal on backbone)
  • 10xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AbsI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: SQ-5CH6-F GCCGCTGCTTCCTGTGAC
• 3′ sequencing primer: IRESA rev aggtttccgggccctcacattg

Resource Information

• Supplemental Documents:
  • pTF-ACE2.gb
• A portion of this plasmid was derived from a plasmid made by: ACE-2 extracellular domain was obtained using a PCR-product kindly provided by Petr V. Sergiev (Lomonosov Moscow State University, Moscow, Russia)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry