Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Ssh2 gRNA#2
(Plasmid #163398)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 163398 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    gRNA backbone
  • Backbone size w/o insert (bp) 2763
  • Total vector size (bp) 2811
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ssh2
  • gRNA/shRNA sequence
    CCGAACACGCTATATGGTCGTGG
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_177710.4
  • Entrez Gene
    Ssh2 (a.k.a. SSH, SSH-2, SSH-2L, mSSH-2L)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ssh2 gRNA#2 was a gift from Takeshi Imai (Addgene plasmid # 163398 ; http://n2t.net/addgene:163398 ; RRID:Addgene_163398)
  • For your References section:

    BMPR-2 gates activity-dependent stabilization of primary dendrites during mitral cell remodeling. Aihara S, Fujimoto S, Sakaguchi R, Imai T. Cell Rep. 2021 Jun 22;35(12):109276. doi: 10.1016/j.celrep.2021.109276. 10.1016/j.celrep.2021.109276 PubMed 34161760