AiP1045-pAAV-mscRE10-minBGpromoter-iCre-WPRE-hGHpA
(Plasmid
#163477)
-
PurposeDirect-expressing iCre AAV Virus
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163477 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA
-
Backbone manufacturerAllen Institute
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCre
-
SpeciesSynthetic
-
Insert Size (bp)1059
- Promoter Beta Globin minimal promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlul (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer CACCACCTGTCAGCTCCTTT
- 3′ sequencing primer AAGGGAGATCCGACTCGTCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Funded by BRAIN initiative.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AiP1045-pAAV-mscRE10-minBGpromoter-iCre-WPRE-hGHpA was a gift from The Allen Institute for Brain Science & Bosiljka Tasic (Addgene plasmid # 163477 ; http://n2t.net/addgene:163477 ; RRID:Addgene_163477) -
For your References section:
Enhancer viruses for combinatorial cell-subclass-specific labeling. Graybuck LT, Daigle TL, Sedeno-Cortes AE, Walker M, Kalmbach B, Lenz GH, Morin E, Nguyen TN, Garren E, Bendrick JL, Kim TK, Zhou T, Mortrud M, Yao S, Siverts LA, Larsen R, Gore BB, Szelenyi ER, Trader C, Balaram P, van Velthoven CTJ, Chiang M, Mich JK, Dee N, Goldy J, Cetin AH, Smith K, Way SW, Esposito L, Yao Z, Gradinaru V, Sunkin SM, Lein E, Levi BP, Ting JT, Zeng H, Tasic B. Neuron. 2021 Mar 23. pii: S0896-6273(21)00159-8. doi: 10.1016/j.neuron.2021.03.011. 10.1016/j.neuron.2021.03.011 PubMed 33789083